Oh for the record I see the mods cleaned up this thread by deleting some posts after my OP.

I just mentioned it because in post 2 it looks like I'm talking to myself when I'd actually responded to ryan9b's post on evolution.

My post was "Umm... sorry but... it wasn't Adam and Eve in the Garden of Eden... it was evolution... you haven't heard?"

What odds will you give me that he doesn't come back?

They are alternatives because they are ways in which gene frequencies change, not because they are better suited to survive (nat. selection), but since other events occur will change their numbers in a population. These are occuring more frequently on a genome wide scale many many times more than natural selection, which is why it is not considered the driving force.

Random variation doesn't necessarily have to be good or bad. Much variation is simply neutral, or it is neutral until an environment is altered and then it can become "good" or "bad".
(sorry, last bolded portion should also be in the part quoted too.)

I'm back! Gotta run now though, but I'll be back again this evening. Then I'll provide some more significant examples of mutations than the standard "small random mutations" which people always talk about, and show how new genes can be made/aquired and how others can be removed, thus resulting in much larger genetic diversity...

This however would not result in evolution? It would be more like a soup than a tree (or bush for the nits). Natural selection, also, is not "the better suited survive" but rather those that have a greater chance of reproducing tend to be more prominent in future generations, correct?

Umm... when Splenda wrote this, there was only two posts in the thread, both done by her.

Yes it would still result in evolution by definition of evolution. Natural selection is not required for evolution to occur. People use natural selection in several different ways, but here's a couple definitions that we can use for this discussion:

-The process by which the forms of organisms in a population that are best adapted to the environment increase in frequency relative to less well adapted forms over a number of generations.

-The differential rate of reproduction of different types in a population as the result of different physiological, anatomical, or behavioral characteristics of the types.

In other words, natural selection as applied to genotypes is due their increased reproduction or survival value. Looking at the first definition here, we can ignore it and show how different forms of organisms (with different genotypes) can increase in number by some of the forces that I listed earlier and not because of natural selection. Hope that makes sense:/

Without natural selection of any kind is it possible to have different phenotypes?

I can't comprehend how there could not be natural selection. Every ... subject? ... would have to die at the same age, reproduce at the same rate, and get the same amount of food correct? (because say one was reproducing more than the others, this higher reproducing subject would increase it's genes throughout the population and the others would be (eek) "selected against."

In short, yes.

Don't worry, most people think that there must be natural selection. I think maybe you are thinking of nat. selection in a different way though? Remember, the ultimate source of genetic variation comes from mutations. Forces (sometimes natural selection) act on these variations to then increase variation in a population (variation can also be decreased too).

Many times new variation which results from natural selection never takes hold in a population and is eventually removed. Also, smaller populations are affected less by selection than larger populations are.

I honestly have no idea what you're talking about. How could new variation be a result of natural selection?

Genes 2, 3, and 4 are increasing in frequency as a result of natural selection. I'm not aware of any part of the definition of selection that requires genes to be acted directly upon. In your example, genes 2, 3, and 4 have become more fit to survive simply because they are working with gene 1.


I'm still not getting you on this point. I'm well aware that there are many mechanisms by which gene frequencies change and variation is introduced. But unless there are selection pressures, all of those mechanisms will be reduced to random processes.

Let me ask a question that I think will clarify what I'm trying to say. Is there any source of non-randomness in evolution that does not derive from natural selection?

In the future it'd be awesome if you could write your responses outside the quotes like I've done. Otherwise it's really difficult to respond point by point.

lol...at least she didn't mention Dawkins for once

Okay so there has been a big topic I have left out so far and it never gets thoroughly discussed when people talk about evolution. In several posts of mine about I listed forces which "drive" evolution. But I also said that the ultimate source of evolution was mutations (in an organisms genetic material), and these mutations are subjected to these driving forces which brings about evolutionary change. This is true. However, the types of mutations that people talk about do not paint an entirely complete picture of how these mutations can occur.

The most common statement people make is that small random mutations occur over time and those mutations which confer some sort of advantage remain while those that don't, get weeded out. This is true in some situations. And there are many instances where this has happened. This is usually a very slow process though, and doesn't account for the levels of genetic diversity that we see today. So how can we produce more variation (and thus allow more evolution to occur)?

Quick background as simply as possible: Genetic information is stored in the DNA inside of our cells. Our cells use this info to grow, divide, carry out everyday functions etc. Humans have 23 "strips" of DNA called chromosomes. We have two copies of every chromosome inside our cells, thus a total of 46. Other living organisms have different numbers of chromosomes, and many of them are not stored in pairs (so they only have one copy of their genetic material, instead of two like we do. If you need more clarification or have ?'s, please ask!)

Certain regions of these DNA strands can be further broken down into genes. These genes are "read" and yield gene products such as proteins. Changes in our DNA sequences are called mutations and sometimes cause changes in an organism...some are deadly, some cause disorders, some are advantageous, some are neutral.

Imagine a sequence of DNA as this:

TGGATTCCGAGTTACCCAC

a small random mutation could cause it to increase in size TGGGATTCCGAGTTACCCAC

decrease in size TGGATTCCGAGTTACCCA_

or change its sequence TGGAATCCGAGTTACCCAC

This change ultimately can change the information stored in the DNA, thus altering some aspect of an organism, maybe it's size, shape, or some function it performs.

These are the small random mutations that people talk about. They occur because the cellular "machinery" organisms have are not perfect, and they often make mistakes. This "machinery" can be more efficient in some organisms than in others, and it's effectiveness can change in different environments.

But there are more ways to get variation than just this. Let's take that DNA strand I posted above and simplify it into this:

-----[gene A]----[gene B]----

pretend that these two genes are used for two unrelated functions in an organism.

(REMEMBER, THE PRIMARY SOURCE OF GENETIC VARIATION, AND THUS EVOLUTION IS CHANGES IN AN ORGANISMS GENETIC MATERIAL SINCE THIS INFO CONTAINS THE INSTRUCTIONS FOR THAT ORGANISM TO LIVE, GROW, DIVIDE, REPLICATE, ETC.)

Now lets say there is a mistake when this organism replicates and this sequence of DNA:

----[gene A]----[gene B]----

turns into this:

----[gene A]----[gene B]----[gene B]----

This organism now has an extra gene B. It now has another gene in its genetic material that it originally did not have.

Now when that organism goes to use gene B there are two of them. If one copy of that gene B gets mutated (the small random mutations I discussed above) then that's okay! Since the other copy is still there and is fully functional.

YOU HAVE JUST LEARNED HOW A TYPE OF HEMOGLOBIN (A PROTEIN IN RED BLOOD CELLS) EVOLVED IN VERTEBRATES and some invertebrates many years ago!

This is one way that genetic material can be mutated in living organisms that is slightly more drastic than the small random mutations often mentioned.

In my next post I will post even larger ways mutations can occur.

Sorry about that wording. New variation (in your DNA for example) doesn't ultimately arise from nat. selection. Nat. selection only can serve to increase or decrease the level of genetic diversity in a pop. I meant something more along the lines of:

-new variation arises through mutation in an organisms genetic material

-this variation is more advantageous than what was originally present, thus this organism can survive or reproduce better than the other members of its species.

-thus this new variation (think of it as a more efficient gene, or more efficient function of some sort) is selected for and increases in numbers in the population

- unfortunately, this new trait doesn't remain after many generations for this particular species for some other reason. Thus, this new trait, which was selected for and would contribute to this organisms evolution, gets removed.

I don't think many of the people reading this thread any longer will be unaware of what you wrote above (edit, 2 posts above now). However one thing I'm thinking is .... these mutations, do you know how much is known about mutation rate (or "mistake" rate as I have heard elsewhere) changing during the evolution timescale?

What I'm getting at is that you are saying "But I also said that the ultimate source of evolution was mutations (in an organisms genetic material), and these mutations are subjected to these driving forces which brings about evolutionary change. This is true." This I think is false (unless by driving forces you mean natural selection). But is it possible that this is derived from natural selection?

What I mean is mutations do not happen at a rate which makes giraffes give birth to alien-looking little green men although IIRC the information in the DNA would make this hypothetically possible. It could be the case that the reason this does not happen, or the reason that the mutations occur at the rate the do, is because of natural selection. If giraffe a was giving birth to "normal" giraffe babies and giraffe b was giving birth to little green men, it could be the case that their mutation rates are now open for natural selection to work it's magic on.

Razz,

Can you explain a little more how the extra gene can get in there? from my understanding (and that is limited) I thought that mutation could only act on an already existing gene. I thought that that a point mutation or a replication mutation was always changing a gene, not adding one.

Hmm how about this:

gene 1: yields super mega sperm that are 1000x better doing what sperm do

gene 2: yields blue eyes

gene 3; yields a small brown patch of skin

gene 4: yields a longer nose

ONLY gene 1 is being selected for (by natural selection) since it provides increased reproduction value. Genes 2,3, and 4 are simply there for the ride and do not confer any added benefit, yet their numbers will increase in the population because of gene 1. They are not being selected for since what info they contain is not the reason they are increasing.




There are, and some just depend on how you look at it. I will try to come up with some examples for you.

Sure no prob!

I don't specifically have tons of knowledge on this, but I can tell you that it most likely has changed a various points. Humans and other animals have developed repair mechanisms to fix these mutations as they occur. Thus, the rate would have changed from what it originally was. Also, different environments (think higher temps. or lower temps here, or a toxic environment) influence mutation rates. There are definitely others, and mutation rates have certainly not remained constant over time.


This is true since I do mean driving forces which include natural selection.


Yes you may be correct in thinking that mutation rates can be what they are as a result of natural selection. (however, realize that in some organisms, high mutation rates are needed while in others low mutation rates are needed....further expanding on this, some organisms need a high mutation rate in certain regions of their genome while they need a low mutation rate in other areas of their genome!!)

Sure I will asap! For evolution to occur, there has to be ways to change whats currently there, but you also can acquire new genes, get rid of genes etc. If this didn't happen, diversity in the world would be much less than it is now.

Mutations can occur anywhere in your genome. Other types of mutations can be much much larger than what people normally think of (as in my gene example) as mutations. There are even bigger ones too.

I'll provide more ways this can happen (and provide actual examples from the world) to show this.

Gotta get a bit of work done now though. I will try to come back tonight, but may not be back until tomorrow. Any other questions, please don't hesitate to post them!

(Before I go, here's a cool science fact. There are ~ 10^13 human cells in your body. Traveling from inside your mouth, into your stomach, and out your rear end, there are ~10^14 microorganisms living inside you. This means only 10% of the cells in your body are actually human! Pretty cool, huh?)

First thanks for discussing this, people I know in real life generally aren't interested in discussing evolution.

I think we're sort of agreeing here. The fact that genes 2, 3, and 4 are increasing is still a result of natural selection IMO. I realize that the selection has nothing to do with their fitness, but their increased frequency is still an indirect result of selection.


That would be awesome.

This is what I was thinking as well. I can understand if someone thinks it's nitty but that's just the way I see it.

Hmm yeah we're just talking semantics here. Nevertheless think about this, let's say an organism has ~25,000 genes (which is close to how many humans have), and only 2 or 3 are undergoing natural selection in this specific scenario, all 24,000+ are going to increase in the population...even if they aren't advantageous ones as natural selection implies. Moot point though so don't even worry about it.

Searched for some vids and diagrams of it to help you out but I couldn't find too much right away. The wiki page is actually okay for once at giving some info http://en.wikipedia.org/wiki/Gene_duplication and links to some ways that this can happen. I can assure you though that it is not some incredibly rare process or anything. Many times this event is related to genetic disorders and diseases that humans have:/

More ways mutations can occur:

-Whole genome duplications- yes this actually does happen and has happened many times before. Instead of getting the correct amount or genetic material when cells divide, they end up getting double of what they should have (usually this happens in reproductive cells, thus the offspring will have double what they should)! This is very common in plants, but it does happen in all other life forms. Now you have an entire extra genome that can be used for new genes/new functions etc. Cyprinid fish are one example of this. We can see that their chromosome numbers have gone from 50 to 100 and some even have 150 or 200 copies.

-Partial genome duplications- instead of a whole genome being added, you can have just parts (as in an extra chromosome) be acquired. This does happen in humans and is the cause of some genetic disorders such as Down Syndrome. (remember though, that this doesn't have to occur and be detrimental, it can be neutral, or even advantageous...if the organism which receives these mistakes can survive and reproduce well enough then these changes can remain)

-changes in chromosome structure- so our DNA is "folded up" and "organized" inside of our cells in a particular way. However, there are ways for this structure to change and new conformations to be had. When this happens, ofter times the order of genes in the DNA can be altered and so can the genes themselves. Thus, new mutations!

-Transposable elements (sometimes referred to as "jumping genes")- sometimes the genes in an organisms DNA can "jump" to other regions of it's DNA. For example, lets pretend we have two chromosomes, 1 and 2

Chromosome 1

----[gene A]----[gene B]----[gene C]----

Chromosome 2

---[gene D]----[gene E]----[gene F]----

now the gene "jumps" and we end up with

Chromosome 1

----[gene A]------------------[gene C]----

Chromosome 2

---[gene D]----[gene E]----[gene B]----[gene F]----

or you could even end up disrupting another gene, or it could go in backwards, or even both events could happen and you would get this:

Chromosome 1

----[gene A]--------------[gene C]----

Chromosome 2

---[gene D]----[ge---[B eneg]---ne E]----[gene F]----

This process can be detrimental, neutral, or advantageous, depending on when, where, and what happens from this.